Sequence ID | >SRA1053824 |
Genome ID | SRR035098.505442 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001819) |
Species | |
Start position on genome | 164 |
End posion on genome | 238 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
caccaagttt |
tRNA gene sequence |
CCGGCGTTCGTTCAACGGATAGGACAGCACTCTTCTAAAGTGCGAATGTGGGTTCGATTC |
Downstream region at tRNA end position |
attcaagttt |
Secondary structure (Cloverleaf model) | >SRA1053824 Arg TCT t ACCA attcaagttt C - G C - G G - C G - C C - G G - C T - A T T T C G T C C A C A A C | + + | | G G C T T G G T G G G C G | + | | T T A G G A C T A A GAAT G - C C - G A - T C - G T - A C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |