Sequence ID | >SRA1053836 |
Genome ID | SRR035098.509679 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001819) |
Species | |
Start position on genome | 385 |
End posion on genome | 312 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
ggtttatact |
tRNA gene sequence |
GCCCCCTTAACTCAGTTGGCCAGAGTGCCTCACTTGTAATGAGGAAGTCTGCGGTTCGAA |
Downstream region at tRNA end position |
taatttcctt |
Secondary structure (Cloverleaf model) | >SRA1053836 Thr TGT t Cgat taatttcctt G - C C C C - G C - G C - G C - G T - A T A T A C G C C A T G A A | | | | | G T C T C A T G C G G C G | | | | T T G G A G T C C A G AAGTC C - G C - G T - A C - G A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |