Sequence ID | >SRA1053899 |
Genome ID | SRR035098.530741 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001819) |
Species | |
Start position on genome | 111 |
End posion on genome | 186 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
ccaccaatac |
tRNA gene sequence |
GCCGCTGTAGCTCAGCTGGTAGAGCACATCATTCGTAATGATGGGGTCGGGGGTTCGAAT |
Downstream region at tRNA end position |
aattcatttg |
Secondary structure (Cloverleaf model) | >SRA1053899 Thr CGT c ACCA aattcatttg G - C C - G C - G G - C C - G T - A G - C T A T T T C C C A C G A A + + | | | G T C T C G G G G G G C G | | | | T T G G A G C T A A GGGTC C - G A - T T - A C - G A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |