| Sequence ID | >SRA1053914 |
| Genome ID | SRR035098.535416 |
| Phylum/Class | 454 Sequencing (SRP001819) |
| Species | |
| Start position on genome | 318 |
| End posion on genome | 393 |
| Amino Acid | Glu |
| Anticodon | CTC |
| Upstream region at tRNA start position |
ttggtggaag |
| tRNA gene sequence |
GGCCCCATCGTATAGAGGCCTAGTACGTCGGCTTCTCATGCCGGTAACGCGGGTTCGAAT |
| Downstream region at tRNA end position |
tttccnnnnn |
| Secondary structure (Cloverleaf model) | >SRA1053914 Glu CTC
g ACCC tttccnnnnn
G - C
G + T
C - G
C - G
C - G
C - G
A - T T A
T C G C C C A
A G A C | | | | | G
G T A T G G C G G G C
G + | | | T T
C G T A C
C T A G TAAC
T + G
C - G
G - C
G - C
C - G
T T
T A
C T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |