| Sequence ID | >SRA1053965 |
| Genome ID | SRR035099.19358 |
| Phylum/Class | 454 Sequencing (SRP001820) |
| Species | |
| Start position on genome | 118 |
| End posion on genome | 43 |
| Amino Acid | Ala |
| Anticodon | GGC |
| Upstream region at tRNA start position |
cggtggattt |
| tRNA gene sequence |
CGGGGATTAGCTCAATTGGGAGAGCGCTTGAATGGCATTCAAGAGGTCGTCAGTTCGATC |
| Downstream region at tRNA end position |
tcttctaaca |
| Secondary structure (Cloverleaf model) | >SRA1053965 Ala GGC
t ACCA tcttctaaca
C C
G - C
G + T
G - C
G - C
A - T
T - A C T
T T A G T C A
T A A A + | | | | G
T C T C G G T C A G C
G | | | | T T
G G A G C
G A G AGGTC
C - G
T - A
T - A
G - C
A - T
A T
T A
G G C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |