Sequence ID | >SRA1054357 |
Genome ID | SRR035099.115116 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001820) |
Species | |
Start position on genome | 71 |
End posion on genome | 144 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
tgactgagct |
tRNA gene sequence |
GCTGGTGTAGCTCAATTGGTAGAGCAGCTGATTTGTAATCAGCAGGTTGCGGGTTCGAGT |
Downstream region at tRNA end position |
aacgattgcg |
Secondary structure (Cloverleaf model) | >SRA1054357 Thr TGT t TCtg aacgattgcg G - C C - G T - A G - C G - C T - A G - C T G T T A C C C A T A A A + | | | G T C T C G G C G G G C G | | | | T T G G A G C T A A AGGTT G - C C - G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |