Sequence ID | >SRA1054575 |
Genome ID | SRR035099.167311 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001820) |
Species | |
Start position on genome | 306 |
End posion on genome | 232 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
cccgttttga |
tRNA gene sequence |
TGGGGCGTCGCCAAGTGGTAAGGCATCGGCCTTTGGAGCCGACATTCGCAGGTTCGAATC |
Downstream region at tRNA end position |
aaaccaacca |
Secondary structure (Cloverleaf model) | >SRA1054575 Gln TTG a GCAA aaaccaacca T - A G - C G - C G - C G - C C - G G - C T A T C G T C C A G A C | | | | | G T A C C G G C A G G C G | | | T T G A G G C T A A CATTC T - A C - G G - C G - C C - G C A T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |