Sequence ID | >SRA1054639 |
Genome ID | SRR035099.180799 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001820) |
Species | |
Start position on genome | 310 |
End posion on genome | 237 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
cttgaaacaa |
tRNA gene sequence |
GGGGCTATAGCTCAGTTGGTAGAGCATTTGCATGGCATGCAAAGGGTCAGGAGTTCGAGT |
Downstream region at tRNA end position |
cccaaaaagc |
Secondary structure (Cloverleaf model) | >SRA1054639 Ala GGC a ACac cccaaaaagc G - C G - C G + T G - C C - G T - A A - T T G T T C C T C A T G A A | | | | | G T C T C G A G G A G C G | | | | T T G G A G C T A A GGGTC T - A T - A T - A G - C C - G A T T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |