| Sequence ID | >SRA1054761 |
| Genome ID | SRR035099.208227 |
| Phylum/Class | 454 Sequencing (SRP001820) |
| Species | |
| Start position on genome | 157 |
| End posion on genome | 74 |
| Amino Acid | Ser |
| Anticodon | GGA |
| Upstream region at tRNA start position |
agtttaataT |
| tRNA gene sequence |
GCCAAGATCGCGTAATCCGGTATCGCGCTACCTTGGAAAGGTAGTTCCTTTGGAATTCTG |
| Downstream region at tRNA end position |
attttttgat |
| Secondary structure (Cloverleaf model) | >SRA1054761 Ser GGA
T GTtt attttttgat
G - C
C - G
C - G
A - T
A - T
G - C
A - T T A
T G A C C C A
T A A C | | | | | A
C T G C G C T G G G C
C | | | T T
G T C G C
G T A G TTCCTTTGGAATT
C - G
T - A
A - T
C - G
C - G
T A
T A
G G A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |