Sequence ID | >SRA1001092 |
Genome ID | SRR001052.116443 |
Search identical group | |
Phylum/Class | Corals, microbial fraction from Porites astreoides tissues (SRP000144) |
Species | |
Start position on genome | 80 |
End posion on genome | 10 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ggcgagctca |
tRNA gene sequence |
TGTAGAGAGGACGAATGGTGAGTCATCGGGCTCATGCTCCGAAGAAGTGGGTTCGATTCC |
Downstream region at tRNA end position |
tgggtannnn |
Secondary structure (Cloverleaf model) | >SRA1001092 Met CAT a Cttt tgggtannnn T - A G - C T - A A - T G - C A - T G - C T T A C A C C C A A A G | | | | | G T G C A G G T G G G C G | | | T T G A G T C T G A AGAA T - A C - G G - C G - C G + T C C T G C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |