Sequence ID | >SRA1001100 |
Genome ID | SRR001052.127192 |
Search identical group | |
Phylum/Class | Corals, microbial fraction from Porites astreoides tissues (SRP000144) |
Species | |
Start position on genome | 29 |
End posion on genome | 111 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
aaattaatag |
tRNA gene sequence |
GCCATTGTGGTGGAAAAGGTAGACACATTAGATTTAAAATCTAACGGCTGAAGGTTGTAT |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >SRA1001100 Leu TAA g Tnnn nnnnnnnnnn G - C C - G C - G A - T T - A T - A G - C T G T T A C T C A A A A G | | | | | A A G G T G A T G A G C G | | | T T G A C A C T A G A CGGCTGAAGGTTGT T - A T - A A - T G - C A - T T A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |