Sequence ID | >SRA1001122 |
Genome ID | SRR001052.176746 |
Search identical group | |
Phylum/Class | Corals, microbial fraction from Porites astreoides tissues (SRP000144) |
Species | |
Start position on genome | 14 |
End posion on genome | 87 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
aaattctaaA |
tRNA gene sequence |
GAACTGGTAGCTTAACGGGTGAAGCTTATTGCTCATAACAATAAAAAGTTGGTTCGATTC |
Downstream region at tRNA end position |
gatcggtatt |
Secondary structure (Cloverleaf model) | >SRA1001122 Met CAT A TTgg gatcggtatt G + T A - T A - T C - G T - A G - C G + T T T T T A A C C A C A A A + | | | | G G T T C G G T T G G C G | | | | T T G A A G C T G T AAAA T - A A - T T - A T - A G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |