Sequence ID | >SRA1002485 |
Genome ID | SRR001324.78052 |
Search identical group | |
Phylum/Class | Metagenomic signatures of the Peru Margin subseafloor biosphere (SRP000183) |
Species | |
Start position on genome | 88 |
End posion on genome | 16 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
atagtttaaT |
tRNA gene sequence |
AGCCTTATAATGTAATGGTAACACAATTGATTTTGGGTCAATTATTAAACGTTCGAATCG |
Downstream region at tRNA end position |
aggagataaa |
Secondary structure (Cloverleaf model) | >SRA1002485 Gln TTG T GAtg aggagataaa A - T G - C C - G C - G T - A T - A A - T T A T T T T G C A A A A | | | | | G T T G T A A A A C G C G | | | T T G A C A C T A A TATT A - T T - A T - A G - C A - T T G T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |