Sequence ID | >SRA1014799 |
Genome ID | SRR023845.319099 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 9 |
End posion on genome | 91 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
nnttaaataa |
tRNA gene sequence |
GCGAGCATGTTGAAATTGGTAGCCAAGCTATTCTTAGGAAATAGTGGTCTTAGACTATGT |
Downstream region at tRNA end position |
taattcctag |
Secondary structure (Cloverleaf model) | >SRA1014799 Leu TAG a Atat taattcctag G - C C - G G - C A - T G + T C - G A - T T G T C A T C C A T A A G | | | | | A T A G T T G T A G G C G | | | T T G C C A A T A G G TGGTCTTAGACTAT C - G T - A A - T T - A T - A C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |