Sequence ID | >SRA1014959 |
Genome ID | SRR023845.398750 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 210 |
End posion on genome | 115 |
Amino Acid | Stop |
Anticodon | CTA |
Upstream region at tRNA start position |
ctcggcggtG |
tRNA gene sequence |
GAGGCGTCAGGGTGTCTGGTGACCCCCGCGGCCTCTAAAGCCGACGTGGCCCGGTACCCG |
Downstream region at tRNA end position |
Acagcccact |
Secondary structure (Cloverleaf model) | >SRA1014959 Stop CTA G CGCC Acagcccact G - C A - T G - C G - C C - G G - C T C T T C T G C C C A C T G A + | | | | G T T G G G G C G G G C G | | | T T G C C C C T G A C CGTGGCCCGGTACCCGGGTCAG G A C - G G - C G - C C - G C A T A C T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |