Sequence ID | >SRA1015079 |
Genome ID | SRR023845.452433 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 69 |
End posion on genome | 153 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
taatgtattT |
tRNA gene sequence |
GGAAAGATATCCAAGCGGTCAAAGGAATTTAATTGTAAATTAAATTAGTTAACTATTCGC |
Downstream region at tRNA end position |
ccttttgatg |
Secondary structure (Cloverleaf model) | >SRA1015079 Tyr GTA T AAac ccttttgatg G - C G + T A - T A - T A - T G - C A - T T A T C G T T C A C G A A | | | | | A G A C C T G C A A G C G | | | T T T A G G A C A A A TTAGTTAACTATTC T - A T - A T - A A - T A - T T A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |