Sequence ID | >SRA1015080 |
Genome ID | SRR023845.452433 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 154 |
End posion on genome | 234 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
ctcttttcaa |
tRNA gene sequence |
ACCCTTTTGATGGAATTGGTAGACATGGTAAATTTAAAATTTACTTTATTATAAGTATTG |
Downstream region at tRNA end position |
tataaattta |
Secondary structure (Cloverleaf model) | >SRA1015080 Leu TAA a Atag tataaattta A - T C - G C - G C - G T - A T - A T - A T A T T G A C C A T A A G | + | | | A T G G T A A T T G G C G | | | T T G A C A T T A G G TTTATTATAAGT G - C T - A A - T A - T A - T T A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |