Sequence ID | >SRA1015125 |
Genome ID | SRR023845.468603 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 75 |
End posion on genome | 147 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
cgggtaagta |
tRNA gene sequence |
AAGGCTATAGCTTAATTGGTAAAGCAAGCTGCTCATGATAGCTCAGATGAGTGTTCGAAT |
Downstream region at tRNA end position |
cgactttctt |
Secondary structure (Cloverleaf model) | >SRA1015125 Met CAT a Aaat cgactttctt A - T A - T G - C G - C C - G T - A A - T T A T C T T A C A T A A A | | + | | G T T T C G G A G T G C G | | | | T T G A A G C T A A CAGAT A - T G - C C - G T - A G + T C A T G C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |