Sequence ID | >SRA1017782 |
Genome ID | SRR035082.196070 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001803) |
Species | |
Start position on genome | 69 |
End posion on genome | 144 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
tttcttaacT |
tRNA gene sequence |
GGGGTTGTGATGTAATCTGGAAGCATTCCACGTTTGGGGCGTGGCTATCACAGTTCAAAT |
Downstream region at tRNA end position |
atatttatct |
Secondary structure (Cloverleaf model) | >SRA1017782 Pro TGG T ATCt atatttatct G - C G - C G - C G + T T - A T - A G - C T A T G T G T C A T A A G | | | | | A C T G T A C A C A G C T + | | | T T G G C A T G A A T CTAT C - G C - G A - T C - G G - C T G T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |