Sequence ID | >SRA1021038 |
Genome ID | SRR035083.201910 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001804) |
Species | |
Start position on genome | 94 |
End posion on genome | 18 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
gtatttacgg |
tRNA gene sequence |
AGCCCGATGATGGAAATGGTCTACATGCTGATTTCAAAAGTCAGATTCTGGGAGTTCGAG |
Downstream region at tRNA end position |
tttataggac |
Secondary structure (Cloverleaf model) | >SRA1021038 Leu CAA g ACTA tttataggac A - T G - C C - G C - G C - G G - C A - T T G T C C C T C A A A A G | | | | | G T G G T A G G G A G C G | | | T T G A C A T T C T G ATTCT C - G T - A G - C A - T T + G T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |