Sequence ID | >SRA1021224 |
Genome ID | SRR035083.226181 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001804) |
Species | |
Start position on genome | 87 |
End posion on genome | 170 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
cctatattaT |
tRNA gene sequence |
GCCCGTATCGCATAAAGGTATTGCACGCGGCTCGAACCCGCGGTCCCTCGGGACATCCCT |
Downstream region at tRNA end position |
ttattttcca |
Secondary structure (Cloverleaf model) | >SRA1021224 Ser CGA T GTCt ttattttcca G - C C - G C - G C - G G - C T - A A - T T T T G G G A C A A A C | | | | | A A T A C G C C C T G C G | | | T T G T T G C T A A GTCCCTCGGGACAT C - G G - C C - G G - C G - C C C T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |