Sequence ID | >SRA1021739 |
Genome ID | SRR035083.300070 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001804) |
Species | |
Start position on genome | 60 |
End posion on genome | 142 |
Amino Acid | Leu |
Anticodon | AAG |
Upstream region at tRNA start position |
ttttttcagg |
tRNA gene sequence |
GCAGGACTTCCCCGAGTGGTTAAAGGGGCACGGTTAAGGGCTGTGTGCTTAGTGCTTCGC |
Downstream region at tRNA end position |
ctttgactat |
Secondary structure (Cloverleaf model) | >SRA1021739 Leu AAG g Atgt ctttgactat G - C C - G A - T G - C G - C A - T C - G T A T C G T C C A T G A G T | | | | | G G C C C C G C A G G C G | | | T T T A G G G T A A G TGCTTAGTGCTTC C - G A - T C - G G + T G - C T G T G A A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |