| Sequence ID | >SRA1030487 |
| Genome ID | SRR035087.286250 |
| Phylum/Class | 454 Sequencing (SRP001808) |
| Species | |
| Start position on genome | 246 |
| End posion on genome | 174 |
| Amino Acid | Pro |
| Anticodon | CGG |
| Upstream region at tRNA start position |
ctgactatgc |
| tRNA gene sequence |
GGGGTCGTGGGGTAGCCTGGAATCCTATGGCGTTCGGGATGCTGTAACCTGAGTTCGAAT |
| Downstream region at tRNA end position |
tttgattaga |
| Secondary structure (Cloverleaf model) | >SRA1030487 Pro CGG
c Attt tttgattaga
G - C
G - C
G - C
G - C
T - A
C - G
G - C T A
T G A C T C A
C G A G | | | | | G
C T G G G C T G A G C
T | | + T T
G T C C T
G A A A TAAC
T + G
G + T
G - C
C - G
G + T
T A
T G
C G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |