Sequence ID | >SRA1032424 |
Genome ID | SRR035088.1266 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001809) |
Species | |
Start position on genome | 85 |
End posion on genome | 167 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
cttatattgT |
tRNA gene sequence |
GCCTCTGTCGCATAATGGTATTGCACTCGGCTTGAGACCGAGGCCCTTCGGGGCATCCCC |
Downstream region at tRNA end position |
tttattctaa |
Secondary structure (Cloverleaf model) | >SRA1032424 Ser TGA T GTtt tttattctaa G - C C - G C - G T + G C - G T - A G - C T T T G G G G C A A A C | | | | | G T T A C G C C C C G C G | | | T T G T T G C T A A GCCCTTCGGGGCAT C - G T - A C - G G - C G - C C A T G T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |