Sequence ID | >SRA1041861 |
Genome ID | SRR035091.306342 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001812) |
Species | |
Start position on genome | 114 |
End posion on genome | 31 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
tatttttttT |
tRNA gene sequence |
GCGAATGTAGTCAATCGGAAACGACAGAAGACTCAAAATCTTTGCATTAGTTGCTAAACA |
Downstream region at tRNA end position |
taatatttat |
Secondary structure (Cloverleaf model) | >SRA1041861 Leu CAA T ATag taatatttat G - C C - G G - C A - T A - T T T G - C T C T T G T T C A C T A A | | | | | G G A C T G A C A A G C G | | | T T A C G A C A A A GCATTAGTTGCTAA G + T A - T A - T G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |