Sequence ID | >SRA1043497 |
Genome ID | SRR035092.126641 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001813) |
Species | |
Start position on genome | 161 |
End posion on genome | 90 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
agtacattaa |
tRNA gene sequence |
AGCAGAGTAGTGTAACGGACGCACGTGAGACTCATAACCTCAAGGAACAAGTTCAACTCT |
Downstream region at tRNA end position |
gaaaataata |
Secondary structure (Cloverleaf model) | >SRA1043497 Met CAT a ACat gaaaataata A A G - C C - G A - T G - C A - T G - C T C T T G T T C A A A A | | | | | A C T G T G A C A A G C G + | | | T T G G C A C A C G AGGA T - A G - C A - T G - C A C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |