Sequence ID | >SRA1044564 |
Genome ID | SRR035092.301956 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001813) |
Species | |
Start position on genome | 324 |
End posion on genome | 399 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
tattaaattT |
tRNA gene sequence |
TTCCCTGTAGCATAATGGATTAGTGCAACAGTTTTCTAAACTGTTACGTGTAAGTTCGAC |
Downstream region at tRNA end position |
aataagggtg |
Secondary structure (Cloverleaf model) | >SRA1044564 Arg TCT T GTta aataagggtg T - A T - A C - G C - G C - G T - A G - C T C T C A T T C A T A A A | | | | | G G T A C G G T A A G C G + | | | T T A G T G C T T A A TACGT A - T C - G A - T G - C T - A T A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |