| Sequence ID | >SRA1049661 |
| Genome ID | SRR035095.112622 |
| Phylum/Class | 454 Sequencing (SRP001816) |
| Species | |
| Start position on genome | 261 |
| End posion on genome | 349 |
| Amino Acid | Gly |
| Anticodon | TCC |
| Upstream region at tRNA start position |
gagaacacaa |
| tRNA gene sequence |
TCGATAGTCGCATAGATTGGTCGAGTGCTCTGGATTTCCAATCCAGCCAGATAAAGTTCA |
| Downstream region at tRNA end position |
caaaaataca |
| Secondary structure (Cloverleaf model) | >SRA1049661 Gly TCC
a TCAA caaaaataca
T C
C - G
G - C
A - T
T - A
A - T
G - C T A
T T A T C C A
T A G A C | | | | | G
T T A C G A T A G G C
G + | | | T T
G G T G C
T C G A T CCAGATAAAGTTCAC
C - G
T - A
G - C
G - C
A - T
T A
T A
T C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |