Sequence ID | >SRA1015569 |
Genome ID | SRR023846.114924 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 84 |
End posion on genome | 7 |
Amino Acid | Gly |
Anticodon | ACC |
Upstream region at tRNA start position |
gccaccgcac |
tRNA gene sequence |
AGGAGTGTAGCTCAGTTGGTTAGAGCGTCGGTCTACCAAAACCGAAGGCCCTCGGTTCGA |
Downstream region at tRNA end position |
tttctcnnnn |
Secondary structure (Cloverleaf model) | >SRA1015569 Gly ACC c GCCA tttctcnnnn A - T G - C G - C A - T G - C T - A G - C T A T G A G C C A T G A A | | | | | G T C T C G C T C G G C G | | | | T T G G A G C T T A G AAGGCC T + G C C G - C G A T - A C A T A A C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |