Sequence ID | >SRA1015794 |
Genome ID | SRR023846.202763 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 220 |
End posion on genome | 143 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
ccctcgatct |
tRNA gene sequence |
GGCCCCGTAGCTCAGCTGGATAGAGCGTCCCCCTCCCTAAGGGGAAGGTCGCCCGTTCGA |
Downstream region at tRNA end position |
gaattccaac |
Secondary structure (Cloverleaf model) | >SRA1015794 Gly CCC t ACCA gaattccaac G - C G + T C - G C - G C - G C - G G - C T A T C G G G C A C G A A | | | | | G T C T C G G C C C G C G | | | | T T G G A G C A T A G AAGGTC T + G C - G C - G C - G C A C A T T C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |