Sequence ID | >SRA1033485 |
Genome ID | SRR035088.270493 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001809) |
Species | |
Start position on genome | 277 |
End posion on genome | 203 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
taatttttgt |
tRNA gene sequence |
GCCGAGATAGCTCAGTCGGTAGAGCAGGGGACTGAAATCCCCGTGTCCGCAGTTCAATTC |
Downstream region at tRNA end position |
gtaaatctca |
Secondary structure (Cloverleaf model) | >SRA1033485 Phe GAA t ACCA gtaaatctca G - C C - G C - G G - C A - T G - C A - T T T T G C G T C A T G A A | | | | | A C C T C G C G C A G C G | | | | T T G G A G C T A A TGTC G G G - C G - C G - C A C C T T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |