| Sequence ID | >SRA1053262 |
| Genome ID | SRR035098.370652 |
| Phylum/Class | 454 Sequencing (SRP001819) |
| Species | |
| Start position on genome | 182 |
| End posion on genome | 256 |
| Amino Acid | Cys |
| Anticodon | GCA |
| Upstream region at tRNA start position |
tcttatttag |
| tRNA gene sequence |
GGTGAAGTGGCCGAGTGGCTAGGCAGAGGTCTGCAAAAACCTCGTACAGCGGTTCGAATC |
| Downstream region at tRNA end position |
gacgaggttt |
| Secondary structure (Cloverleaf model) | >SRA1053262 Cys GCA
g TCCA gacgaggttt
G - C
G - C
T - A
G - C
A - T
A - T
G - C T A
T T C G C C A
G A G | | | | | G
T G C C G A G C G G C
G | | | T T
G A G G C
C T A CGTAC
G + T
A C
G - C
G A
T - A
C A
T A
G C A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |