Sequence ID | >ENV09000324 |
Genome ID | ABSN01050803 |
Search identical group | |
Phylum/Class | Freshwater sediment metagenome lwFormaldehyde_C1 |
Species | |
Start position on genome | 751 |
End posion on genome | 677 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
gttttcttgt |
tRNA gene sequence |
GCAGTCATAGTATAGCCTGGTTAGTATTCGGGGTTTCCAACCCTGTGACGCGGGTTCGAA |
Downstream region at tRNA end position |
caatctaaag |
Secondary structure (Cloverleaf model) | >ENV09000324 Gly TCC t ACtt caatctaaag G - C C - G A - T G - C T - A C - G A - T T A T C G C C C A C C G A A | | | | | G T T A T G G C G G G C G + | | + T T G G T A T T T A T TGAC C - G G + T G - C G - C G - C T A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |