| Sequence ID | >ENV09000945 |
| Genome ID | ABSQ01001688 |
| Phylum/Class | Freshwater sediment metagenome lwMethenol_C1 |
| Species | |
| Start position on genome | 690 |
| End posion on genome | 616 |
| Amino Acid | Met |
| Anticodon | CAT |
| Upstream region at tRNA start position |
gggccgccac |
| tRNA gene sequence |
GGCGGAGTAGCTCAGTGGTAGAGCAGGGGACTCATAAGCCCTTGGTCGGTGGTTCAAATC |
| Downstream region at tRNA end position |
gacaccgtgt |
| Secondary structure (Cloverleaf model) | >ENV09000945 Met CAT
c ACCA gacaccgtgt
G + T
G - C
C - G
G - C
G - C
A - T
G - C T A
T C C G C C A
G A A | | + | | A
T C T C G G G T G G C
G | | | | T T
G G A G C
T A A TGGTC
G + T
G - C
G - C
G - C
A G
C A
T A
C A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |