| Sequence ID | >ENV09003661 |
| Genome ID | ADGO01124288 |
| Phylum/Class | Compost metagenome contig00001 |
| Species | |
| Start position on genome | 225 |
| End posion on genome | 132 |
| Amino Acid | Ser |
| Anticodon | GCT |
| Upstream region at tRNA start position |
atttcgtcac |
| tRNA gene sequence |
GGTGAGGTGGCCGAGAGGCTGAAGGCGGCGGTTTGCTAAACCGTTGTAGGGCCTAAAAGC |
| Downstream region at tRNA end position |
tacttcgctc |
| Secondary structure (Cloverleaf model) | >ENV09003661 Ser GCT
c GCCA tacttcgctc
G - C
G - C
T - A
G - C
A - T
G - C
G - C T A
T G T C C C A
A G A G | | | | | G
G G C C G C A G G G C
G | | | T T
C A G G C
T G A G TGTAGGGCCTAAAAGCTCTACC
G + T
C - G
G - C
G - C
T - A
T A
T A
G C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |