Sequence ID | >ENV09003911 |
Genome ID | ADGO01211798 |
Search identical group | |
Phylum/Class | Compost metagenome contig00001 |
Species | |
Start position on genome | 156 |
End posion on genome | 85 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
accggttcgt |
tRNA gene sequence |
GCGGACGTAGCTCAATGGTAGAGCCCCAGTCTTCCAAACTGGCAGCGCGGGTTCGATTCC |
Downstream region at tRNA end position |
agacgcgaag |
Secondary structure (Cloverleaf model) | >ENV09003911 Gly TCC t TCac agacgcgaag G - C C - G G - C G - C A - T C - G G - C T T T T G C C C A A A A + | | | | G T C T C G G C G G G C G | | | | T T G G A G C T A C CAGC C - G C - G A - T G - C T - A C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |