Sequence ID | >FG090100034 |
Genome ID | AE016818 |
Search identical group | |
Phylum/Class | Ascomycota |
Species | Ashbya gossypii ATCC 10895 |
Chromosome | chr5 |
Start position on genome | 49708 |
End posion on genome | 49783 |
Amino Acid | Val |
Anticodon | AAC |
Upstream region at tRNA start position |
agcaatagtaattcactttagcataagaggtttctgaattattatcacgttcatgttcttctgcgctaacatcacctgtccaataagagcctgcagaaaT |
tRNA gene sequence |
GGTTTCGTGGTCTAGTCGGTTATGGCATCTGCTTAACACGCAGAACGTCCCCAGTTCGAT |
Downstream region at tRNA end position |
ctttttgtacccatcatgatcactcacgtgccctaaagatggcccatactcatcccaaatgctgtgagaggccaaggtttacggcggcccttgcgctaga |
Secondary structure (Cloverleaf model) | >FG090100034 Val AAC T ATtt ctttttgtacccatcatgatcactcacgtgccctaaagatggcccatactcatcccaaatgctgtgagaggccaaggtttacggcggcccttgcgctaga G - C G + T T - A T - A T - A C - G G - C C T T G G G T C A T G A G | | | | | G C T C T G C C C A G C G | + | T T G T G G C T T A A ACGTC T - A C - G T - A G - C C - G T C T A A A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |