Sequence ID | >FG090100214 |
Genome ID | CR380958 |
Search identical group | |
Phylum/Class | Ascomycota |
Species | Candida glabrata CBS 138 CBS138 |
Chromosome | chrL |
Start position on genome | 134605 |
End posion on genome | 134535 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
gaccattccttgttaggttgaatccatacgcttacaaggaaaaaatactgtagcctgataaggtggtatcattttgcaaggtaaatcaacaagtagttcc |
tRNA gene sequence |
GCGCAAGTGGTTTAGTGGTAAAATCCAACGTTGCCATCGTTGGGCCCCCGGTTCGATTCC |
Downstream region at tRNA end position |
ttttttatacctcgaggtttgaggttttattgccctcaatatctaataatcgcaacctattctaggttcatcaagtatgggcacaaattacataacttcc |
Secondary structure (Cloverleaf model) | >FG090100214 Gly GCC c Atac ttttttatacctcgaggtttgaggttttattgccctcaatatctaataatcgcaacctattctaggttcatcaagtatgggcacaaattacataacttcc G - C C - G G - C C - G A - T A - T G - C T T T G G G C C A G A G | | | | | G T T T T G C C C G G C G | | | + T T G A A A T T A C GGCC C - G A - T A - T C - G G - C T T T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |