Sequence ID | >FG090100301 |
Genome ID | CR382137 |
Search identical group | |
Phylum/Class | Ascomycota |
Species | Debaryomyces hansenii CBS767 |
Chromosome | chrE |
Start position on genome | 1246887 |
End posion on genome | 1246815 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
atagaaatatagtagataacttctttgaagatataaaacacacaattctgtaactatcacctcatagctaaccacacactttaaaaccatataacaatct |
tRNA gene sequence |
GCCTGCGTAGCGTAATGGTTAACGCGTTTGACTTCTAATCAAAAGATTGCGGGTTCGACT |
Downstream region at tRNA end position |
ttgtgcggatttagctcagttgggagagcgtcagactgaagtcaacttcagtccagttaatctgaaggtcctgtgttcgatccacagaattcgcataatt |
Secondary structure (Cloverleaf model) | >FG090100301 Arg TCT t Ttgt ttgtgcggatttagctcagttgggagagcgtcagactgaagtcaacttcagtccagttaatctgaaggtcctgtgttcgatccacagaattcgcataatt G + T C - G C - G T + G G + T C - G G - C T C T C G C C C A T A A A | | | | | G G T G C G G C G G G C G | | | | T T T A C G C T A G AGATT T - A T - A T - A G - C A - T C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |