Sequence ID | >FG090100697 |
Genome ID | CR382128 |
Search identical group | |
Phylum/Class | Ascomycota |
Species | Yarrowia lipolytica CLIB122 |
Chromosome | chrB |
Start position on genome | 2938459 |
End posion on genome | 2938532 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
aggcactcagaaccatttttcccctcagaataacttttttgccgctcacgtgatgtgttatgggtctagccatggaatttttttcaatttttttaagttc |
tRNA gene sequence |
GGTCGTGTGGTGTAATGGTTATCACGTCCCGCTCACACCGGGGAGGCTCGGAGTTCGATC |
Downstream region at tRNA end position |
ttttctttttttcttcttcctctgacgcggaaatgcttttgcttttgcgatgtgcttctaattgacaacattatctacaagctggcattacaaaacacta |
Secondary structure (Cloverleaf model) | >FG090100697 Val CAC c ACtt ttttctttttttcttcttcctctgacgcggaaatgcttttgcttttgcgatgtgcttctaattgacaacattatctacaagctggcattacaaaacacta G - C G + T T - A C - G G + T T - A G - C C T T G C C T C A T A A G | | | | | G G T G T G C G G A G C G | | | T T T T C A C T A G AGGCT T + G C - G C - G C - G G - C C C T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |