Sequence ID | >FG090700008 |
Genome ID | CR382128 |
Search identical group | |
Phylum/Class | Ascomycota |
Species | Yarrowia lipolytica CLIB122 |
Chromosome | chrB |
Start position on genome | 2550542 |
End posion on genome | 2550625 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
tattttttattctaatgatttattacagctatatatttttccggcgattttttctgtaattttgatccaccagccgagatttccaaaattcggaaaattc |
tRNA gene sequence |
GGTTGTGTAGTGTAGTGGTTATCACTCCAGATTTTGATTCTGGGAACCCCGGTTCGAGCC |
Downstream region at tRNA end position |
gtttgggtgttttatttttgcacttttgccttatttggtctgtaagccaatcacatcgttccatgtgggtccgttgccaccgtttttcctgcgcgccgat |
Secondary structure (Cloverleaf model) | >FG090700008 Gln TTG c Tttt gtttgggtgttttatttttgcacttttgccttatttggtctgtaagccaatcacatcgttccatgtgggtccgttgccaccgtttttcctgcgcgccgat G - C G - C T - A T + G G - C T - A G - C C G T G G G C C A T G A A | | | | | G G T G T G C C C G G C G | | | T T T T C A C T A T GAAC C - G C - G A - T G - C A - T T T T A * T T G intron: position=38, length=12 (in A-loop) TTCAATTTAAAG |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |