Sequence ID | >FG090800137 |
Genome ID | CR382129 |
Search identical group | |
Phylum/Class | Ascomycota |
Species | Yarrowia lipolytica CLIB122 |
Chromosome | chrC |
Start position on genome | 1873222 |
End posion on genome | 1873136 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
caaaatcaaggttcggtttcttggtctagttggtcatggcatctgcttaacacgcagaacgtcggcagttcgatcctgccagaaatcatcctttcttcac |
tRNA gene sequence |
GGTTGTATAGTGTAGCGGTTATCACCTTGGATTCTGATTCCAGTAACCCCGGTTCGATTC |
Downstream region at tRNA end position |
tgtcctttttgtcctttttgccttgacgagaaccagatttgcatattttttgggctcattcggaagcccttgatgacatctctttattggtgaagtcctc |
Secondary structure (Cloverleaf model) | >FG090800137 Gln CTG c Tttt tgtcctttttgtcctttttgccttgacgagaaccagatttgcatattttttgggctcattcggaagcccttgatgacatctctttattggtgaagtcctc G - C G - C T - A T + G G - C T - A A - T T T T G G G C C A C G A A | | | | | G G T G T G C C C G G C G | | | T T T T C A C T A C TAAC T + G T - A G - C G - C A - T T T T A * C T G intron: position=38, length=15 (in A-loop) CTCTTAATAGTCGAC |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |