Sequence ID | >FU090900028 |
Genome ID | CR380952 |
Search identical group | |
Phylum/Class | Ascomycota |
Species | Candida glabrata CBS 138 CBS138 |
Chromosome | chrF |
Start position on genome | 879028 |
End posion on genome | 878909 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
ttggtatcgcagtaataagaatagctccgtatgatttctgatgaaaatttaggtacttcttatacctcaatcctgattaccctttcaacaaatacagtat |
tRNA gene sequence |
GGTTGTTTGGCCGAGCGGTCTAAGGCGCCTGATTCAAGCTCAGGTATCGTAAGATGCAAG |
Downstream region at tRNA end position |
attttttttaatttgatagtgtactattgcgtctataacgataaacaatactacactgtattgaatgtatgatatattccatgaacttaaacagtctata |
Secondary structure (Cloverleaf model) | >FU090900028 Leu CAA t Atta attttttttaatttgatagtgtactattgcgtctataacgataaacaatactacactgtattgaatgtatgatatattccatgaacttaaacagtctata G - C G - C T - A T - A G - C T + G T - A T A T T T C T C A C G A G | | | | | G G G C C G A A G A G C G | | | T T T A G G C C T A G TATCGTAAGATGC C - G C - G T - A G - C A - T T C T G * C A A intron: position=38, length=38 (in A-loop) TTGAAACATTACTTACTGGGTTAACAAACTCAGGAGCA |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |