Sequence ID | >FU090900050 |
Genome ID | CR380958 |
Search identical group | |
Phylum/Class | Ascomycota |
Species | Candida glabrata CBS 138 CBS138 |
Chromosome | chrL |
Start position on genome | 177418 |
End posion on genome | 177331 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
ggaatatagctaaaaaccacttaaaataaatagatattcaaaatttgctattactgagtgaaggtaagctaccatacctgaaataacatcaatttaatta |
tRNA gene sequence |
CTCTCGGTAGCCAAGTTGGTTTAAGGCGCAAGACTGTAAATCTTGAGATCGGGCGTTCGA |
Downstream region at tRNA end position |
tttttttaatttctttgttttttatattcgtaagaaccgaatttgtagtatattggatattcgctagtaaaccccatctactaccaaccgctatatactt |
Secondary structure (Cloverleaf model) | >FU090900050 Tyr GTA a Atat tttttttaatttctttgttttttatattcgtaagaaccgaatttgtagtatattggatattcgctagtaaaccccatctactaccaaccgctatatactt C - G T - A C - G T + G C - G G - C G - C T A T C C C G C A T T G A A | | | | | G G A C C G G G G C G C G | | | T T T A G G C T T A G AGATC C - G A - T A - T G - C A - T C A T A * G T A intron: position=38, length=13 (in A-loop) TTTCAACACTGAA |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |