Sequence ID | >FU090900059 |
Genome ID | AE017345 |
Search identical group | |
Phylum/Class | Basidiomycota |
Species | Cryptococcus neoformans var. neoformans JEC21 |
Chromosome | chr5 |
Start position on genome | 1279571 |
End posion on genome | 1279485 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
gattacaaacggcagtcctatggctgtttccttctggtatggtgtttaaaagtaagctaactccttatgtagtctttaagagaagtttaacaacaagttg |
tRNA gene sequence |
GGGTTTGTAGTGTAGTGGTATCGCGCTTCATTTGGGTTGAAGAGGTCCCGCGTTCGATCC |
Downstream region at tRNA end position |
acaatttttttgtttttacattcatcctcgcaaaagttttcttgtttttatgcatctagctggcagaagcgtagtactggaacatctagttaggacaatt |
Secondary structure (Cloverleaf model) | >FU090900059 Pro TGG g Ccaa acaatttttttgtttttacattcatcctcgcaaaagttttcttgtttttatgcatctagctggcagaagcgtagtactggaacatctagttaggacaatt G - C G - C G - C T - A T + G T T G - C C T T G G C G C A G A A | | | | | G T T G T G C C G C G C G | + | T T G T C G C T A G AGGTC C - G T - A T - A C - G A - T T T T G * T G G intron: position=38, length=15 (in A-loop) CTTCAAGGAGCACCG |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |