Sequence ID | >FU090900115 |
Genome ID | CR382138 |
Search identical group | |
Phylum/Class | Ascomycota |
Species | Debaryomyces hansenii CBS767 |
Chromosome | chrF |
Start position on genome | 969456 |
End posion on genome | 969547 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
gacatctaaccgagcaagcattcacgtatctaatctttttacaaaaagattatatacaagcatatgataaagaagaaataatttgtagaagatataaagc |
tRNA gene sequence |
GACAATGTGGCCGAGTGGTTAAGGCGACGCACTCGAAATGCGTTGGGATTTCCCGCGCAG |
Downstream region at tRNA end position |
ttttttttttgttttctggctctcatcgcgcattatggattacggtggttcaccatagtaaagagtagctactatttacttttcttattttttatagaca |
Secondary structure (Cloverleaf model) | >FU090900115 Ser CGA c Gtta ttttttttttgttttctggctctcatcgcgcattatggattacggtggttcaccatagtaaagagtagctactatttacttttcttattttttatagaca G - C A - T C - G A - T A - T T + G G + T T A T C G T C C A T G A G | | | | | G G G C C G G C A G G C G | | | T T T A G G C T A G TGGGATTTCCCGC A - T C - G G - C C - G A - T C A T A * C G A intron: position=38, length=11 (in A-loop) TAATTAGAGTG |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |