Sequence ID | >FU090900183 |
Genome ID | CP000501 |
Search identical group | |
Phylum/Class | Ascomycota |
Species | Pichia stipitis CBS 6054 |
Chromosome | chr7 |
Start position on genome | 234302 |
End posion on genome | 234213 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
aattatgcaattttgctgcaatcgtccgaaaaacgtgatatatatcacgtgatatttaaatgaaatggattacataggatctttttttcaatgaatgagg |
tRNA gene sequence |
GCCTGGCTAGCTCAATGGCTAGAGCGTTTGACTTTTAATCAAAAGGTTGCGGGTTCGACC |
Downstream region at tRNA end position |
tttttattttgtaattgtcaattatattgtcactgttctcttatgattctacagttatagtaaatttcctaaaactaattacaacgtgtattcaagaatt |
Secondary structure (Cloverleaf model) | >FU090900183 Lys TTT g Ttat tttttattttgtaattgtcaattatattgtcactgttctcttatgattctacagttatagtaaatttcctaaaactaattacaacgtgtattcaagaatt G - C C - G C - G T + G G - C G + T C - G C C T C G C C C A T A A A | | | | | G G C T C G G C G G G C G | | | | T T C G A G C T A G AGGTT T - A T - A T - A G - C A - T C A T A * T T T intron: position=38, length=17 (in A-loop) TGCACTTCCATAAAGGT |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |