Sequence ID | >FU090900209 |
Genome ID | CR382128 |
Search identical group | |
Phylum/Class | Ascomycota |
Species | Yarrowia lipolytica CLIB122 |
Chromosome | chrB |
Start position on genome | 508688 |
End posion on genome | 508774 |
Amino Acid | Pro |
Anticodon | AGG |
Upstream region at tRNA start position |
tctaaactcccttttaaagtctttcaccaacatttttccaatttttctcttctaattctgtccttatgtagcacatcaccaccccgagctctcatccagt |
tRNA gene sequence |
GGCCCGATGGTTTAGTGGTATAATTCTCGCTTAGGGTGCGAGAGGTCCCGGGTTCAATTC |
Downstream region at tRNA end position |
cctttttgctattctcagcatctattcatgcctccggaatgttttttggtgacctcgatatcactatatctcgattgcgggtgggtgcagttatgatcat |
Secondary structure (Cloverleaf model) | >FU090900209 Pro AGG t Ctat cctttttgctattctcagcatctattcatgcctccggaatgttttttggtgacctcgatatcactatatctcgattgcgggtgggtgcagttatgatcat G - C G - C C - G C - G C - G G + T A - T T T T G G C C C A G A G | | | | | A T T T T G C C G G G C G | | + T T G T A A T T A T AGGTC C - G T - A C - G G - C C - G T T T G * A G G intron: position=38, length=15 (in A-loop) TGATCCTGGGCAATT |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |