Sequence ID | >FG091100001 |
Genome ID | AE016814 |
Search identical group | |
Phylum/Class | Ascomycota |
Species | Ashbya gossypii ATCC 10895 |
Chromosome | chr1 |
Start position on genome | 524796 |
End posion on genome | 524867 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
aaggctggttcgctatatagcgcgacgcgtcgcgttttcgcagcgcacgtgggcccgccggcgcactacggtgcagtgtagcgcgtttttaggcacaagc |
tRNA gene sequence |
GCCATCTTAGTATAGTGGTTAGTACACAACGTTGTGGCCGTTGAAACCCTGGTTCGATTC |
Downstream region at tRNA end position |
tttgcactggaacgaggctatcacgtgacagaaatccttgtttacgttccggattcggcaaccgtctttccagaaacggaactagcgaccggatctctgg |
Secondary structure (Cloverleaf model) | >FG091100001 His GTG c Attt tttgcactggaacgaggctatcacgtgacagaaatccttgtttacgttccggattcggcaaccgtctttccagaaacggaactagcgaccggatctctgg G - C C - G C - G A - T T - A C - G T - A T T T G G A T C A T G A A | | | + | G G T A T G C C T G G C G + | | | T T T G T A C T A A AAAC C - G A - T A - T C - G G - C T C T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |