Sequence ID | >FG091100014 |
Genome ID | AE016815 |
Search identical group | |
Phylum/Class | Ascomycota |
Species | Ashbya gossypii ATCC 10895 |
Chromosome | chr2 |
Start position on genome | 854292 |
End posion on genome | 854220 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
cggaaataaactgcagtcaatacagggtcatggtatcttttaatgctactagccagacttacagacatataccaatctatagatgttaatctaacatcca |
tRNA gene sequence |
TCCGATATAGTGTAACGGCTATCACATCACGCTCTCACCGTGGAGACCCGGGTTCGACTC |
Downstream region at tRNA end position |
ttttgcttggacttctcacactaacaatcctgtcggactgtgcaataggtagaccgtgggtgagaccccatcgcgcgcatatgtttttggtgtgaaagca |
Secondary structure (Cloverleaf model) | >FG091100014 Glu CTC a GCat ttttgcttggacttctcacactaacaatcctgtcggactgtgcaataggtagaccgtgggtgagaccccatcgcgcgcatatgtttttggtgtgaaagca T - A C - G C - G G - C A - T T - A A - T T C T G G C C C A C A A A | | | | | G G T G T G C C G G G C G | | | T T C T C A C T A A AGAC T + G C - G A - T C - G G - C C C T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |